BIOSCAN_1M Insect Dataset

Dataset Overview

BIOSCAN‑1M Insect Dataset provides information about insects, with each record containing the following four main attributes:

1. DNA Barcode Sequence
2. Barcode Index Number (BIN)
3. Taxonomic Rank Annotation
4. RGB Image

I. DNA Barcode Sequence

The provided DNA barcode sequence displays the nucleotide arrangement:

• Adenine (A): Red
• Thymine (T): Blue
• Cytosine (C): Green
• Guanine (G): Yellow

Example sequence:

TTTATATTTTATTTTTGGAGCATGATCAGGAATAGTTGGAACTTCAATAAGTTTATTAATTCGAACAGAATTAAGCCAACCAGGAATTTTTA …

II. Barcode Index Number (BIN)

BIN serves as an alternative to Linnaean names, offering a gene‑centered classification.

Example BIN:

BOLD:AER5166

III. Taxonomic Rank Annotation

Annotations are organized hierarchically based on evolutionary relationships, grouping species that share common features and genetic similarity.

IV. RGB Image

Images are sourced from the 16 most densely sampled orders in the BIOSCAN‑1M Insect Dataset. Below each image, a number indicates the count of images in that class, clearly showing the class imbalance within the dataset.

Diptera: 896,234	Hymenoptera: 89,311	Coleoptera: 47,328	Hemiptera: 46,970
Lepidoptera: 32,538	Psocodea: 9,635	Thysanoptera: 2,088	Trichoptera: 1,296
Orthoptera: 1,057	Blattodea: 824	Neuroptera: 676	Ephemeroptera: 96
Dermaptera: 66	Archaeognatha: 63	Plecoptera: 30	Embioptera: 6

Class Distribution

The dataset visualizes class distribution and imbalance, reflecting an inherent characteristic of insect communities.